Protocol for COVID-19 detection Rachel Chen Grade 12, Toronto On Canada Mar 28,2020
Protocol for COVID-19 detection (Need PPE Level 2 Lab to do this detection)
Rachel Chen Grade 12 , Toronto Ontario, Canada
RNA preparation
1. Collect a sample from a patient; sputum, aspirate or lavage from lower respiratory tract, and nasopharyngeal and oropharyngeal swabs, nasopharyngeal wash/nasopharyngeal aspirate from the upper respiratory tract.
2. Lyse the cells with 1 ml Trizol reagent. Pass the lysate through a pipette several times.
3. Incubate the homogenized samples for 5 minutes at 15 to 30°C.
4. Add 0.2 ml of chloroform per ml of Trizol and cap sample tubes securely.
5. Shake tubes vigorously by hand for 15 seconds and incubate them at 15 to 30°C for 2 to 3 minutes.
6. Centrifuge the samples at no more than 12,000g for 15 minutes at 2 to 8°C.
7. Transfer the colourless upper aqueous phase to a fresh tube.
8. Precipitate the RNA from the aqueous phase by mixing with 0.5 ml isopropyl alcohol. Incubate samples at 15 to 30°C for 10 minutes and centrifuge at no more than 12,000g for 10 minutes at 2 to 8°C.
9. Remove the supernatant. Wash the RNA pellet once with at least 1 ml of 75% ethanol (prepared using RNase-free water). Mix the sample by vortexing and centrifuge at no more than 7,500g for 5 minutes at 2 to 8°C.
10. Briefly dry the RNA pellet (air-dry or vacuum-dry for 5-10 minutes). Do not dry the RNA by centrifugation under vacuum. It is important not to let the RNA pellet dry completely as this will greatly decrease its solubility.
11. Dissolve RNA in RNase-free water or 0.5% SDS solution by passing the solution a few times through a pipette tip, and incubating for 10 minutes at 55 to 60°C.
Reverse Transcription Reaction
1. Before performing the RT reaction, heat 5 μg of total RNA in a 10μl volume at 65°C for 5 to 10 minutes and then quench on ice to denature the RNA.
2. Set up the following components in a 1.5 ml Eppendorf tube:
10.0 μl heat denatured RNA
3.0 μl 10 x PCR buffer
2.5 μl 10mM dNTPs
6.0 μl 25mM MgCl2
1.0 μl random primers (1.0 μg)
0.5 μl reverse transcriptase
17.0 μl water
3. Leave the samples at 25°C for 10 minutes then incubate at 42°C for 1 hour.
4. Denature the cDNA at 95°C and place on ice.
PCR and Product Analysis
1. Set up the following components in a 0.5ml PCR tube:
6.0 μl cDNA product
1.5 μl 10 x PCR buffer
0.2 μl Taq polymerase
0.5 μl SARS-CoV-2 forward primer 5’ CCCTGTGGGTTTTACACTTAA3’ (100 ng)
0.5 μl SARS-CoV-2 reverse primer 5’ACGATTGTGCATCAGCTGA3’ (100 ng)
10.3 μl ddH2O
2. Perform PCR with 30 cycles of denaturation: 30 seconds at 95°C; annealing: 45 seconds at 60°C; and extension 60 seconds at 72°C to amplify cDNA within 1 hour.
3. DNA electrophoresis in 1.5% Agarose gel in TAE buffer and 100bp size as positive result.
4. Further purify PCR products with PCR purification kits from Qiangen following the manuscript protocol.
4. Sequence the PCR products using SARS-CoV-2 forward primer 5’CCCTGTGGGTTTTACACTTAA3’.
5. Use NCBI Gene bank sequence aligning software comparing the known SARS-CoV-2 sequence with the DNA from RT-PCR to detect if a patient has COVID-19.
Reference: